Define where the pipeline should find input data and save output data.

Path to comma-separated file containing information about the samples in the experiment.

required
type: string
pattern: ^\S+\.csv$

Protocol for constructing smRNA-seq libraries.

type: string

The output directory where the results will be saved. You have to use absolute paths to storage on Cloud infrastructure.

required
type: string

Email address for completion summary.

type: string
pattern: ^([a-zA-Z0-9_\-\.]+)@([a-zA-Z0-9_\-\.]+)\.([a-zA-Z]{2,5})$

MultiQC report title. Printed as page header, used for filename if not otherwise specified.

type: string

Reference genome related files and options required for the workflow.

Name of iGenomes reference.

type: string

Boolean whether MirGeneDB should be used instead of miRBase

type: boolean

Species for miRTrace.

type: string

Species of MirGeneDB.

type: string

Path to reference genome FASTA genome file.

type: string

GFF/GTF file with coordinates positions of precursor and miRNAs.

type: string

GFF/GTF file with coordinates positions of precursor and miRNAs.

type: string

Path to FASTA file with mature miRNAs.

type: string
default: https://mirbase.org/ftp/CURRENT/mature.fa.gz

Path to FASTA file with MirGeneDB mature miRNAs.

type: string

Path to FASTA file with miRNAs precursors.

type: string
default: https://mirbase.org/ftp/CURRENT/hairpin.fa.gz

Path to FASTA file with miRNAs precursors.

type: string

Path to a Bowtie 1 index directory

type: string

Save generated reference genome files to results.

type: boolean

Directory / URL base for iGenomes references.

hidden
type: string
default: s3://ngi-igenomes/igenomes

Do not load the iGenomes reference config.

hidden
type: boolean

Options for trimming reads and primers.

The number of basepairs to remove from the 5’ end of read 1.

type: integer

The number of basepairs to remove from the 3’ end of read 1 AFTER adapter/quality trimming has been performed.

type: integer

Sequencing adapter sequence to use for trimming.

type: string
default: TGGAATTCTCGGGTGCCAAGG

Trim FastQ files

type: boolean
default: true

Minimum filter length for raw reads.

type: integer
default: 17

Maximum filter length for raw reads.

type: integer
default: 40

Save reads failing trimming

type: boolean

FastA with known miRNA adapter sequences for adapter trimming

type: string
default: ${projectDir}/assets/known_adapters.fa

Options to remove contamination from the reads.

Enables the contamination filtering.

type: boolean

Path to the rRNA fasta file to be used as contamination database.

type: string

Path to the tRNA fasta file to be used as contamination database.

type: string

Path to the cDNA fasta file to be used as contamination database.

type: string

Path to the ncRNA fasta file to be used as contamination database.

type: string

Path to the piRNA fasta file to be used as contamination database.

type: string

Path to an additional fasta file to be used as contamination database.

type: string

Switches to skip specific pipeline steps, if desired.

Skip all QC steps

type: boolean

Skip FastQC

type: boolean

Skip miRDeep

type: boolean

Skip MultiQC

type: boolean

Skip FastP

type: boolean

Parameters used to describe centralised config profiles. These should not be edited.

Git commit id for Institutional configs.

hidden
type: string
default: master

Base directory for Institutional configs.

hidden
type: string
default: https://raw.githubusercontent.com/nf-core/configs/master

Institutional config name.

hidden
type: string

Institutional config description.

hidden
type: string

Institutional config contact information.

hidden
type: string

Institutional config URL link.

hidden
type: string

Set the top limit for requested resources for any single job.

Maximum number of CPUs that can be requested for any single job.

hidden
type: integer
default: 16

Maximum amount of memory that can be requested for any single job.

hidden
type: string
default: 128.GB
pattern: ^\d+(\.\d+)?\.?\s*(K|M|G|T)?B$

Maximum amount of time that can be requested for any single job.

hidden
type: string
default: 240.h
pattern: ^(\d+\.?\s*(s|m|h|day)\s*)+$

Less common options for the pipeline, typically set in a config file.

Display help text.

hidden
type: boolean

Method used to save pipeline results to output directory.

hidden
type: string

Email address for completion summary, only when pipeline fails.

hidden
type: string
pattern: ^([a-zA-Z0-9_\-\.]+)@([a-zA-Z0-9_\-\.]+)\.([a-zA-Z]{2,5})$

Send plain-text email instead of HTML.

hidden
type: boolean

File size limit when attaching MultiQC reports to summary emails.

hidden
type: string
default: 25.MB
pattern: ^\d+(\.\d+)?\.?\s*(K|M|G|T)?B$

Do not use coloured log outputs.

hidden
type: boolean

Incoming hook URL for messaging service

hidden
type: string

Custom config file to supply to MultiQC.

hidden
type: string

Custom logo file to supply to MultiQC. File name must also be set in the MultiQC config file

hidden
type: string

Custom MultiQC yaml file containing HTML including a methods description.

type: string

Directory to keep pipeline Nextflow logs and reports.

hidden
type: string
default: ${params.outdir}/pipeline_info

Boolean whether to validate parameters against the schema at runtime

hidden
type: boolean
default: true

Show all params when using --help

hidden
type: boolean

Run this workflow with Conda. You can also use ‘-profile conda’ instead of providing this parameter.

hidden
type: boolean