Define where the pipeline should find input data and save output data.

Input FastQ files (gzip compressed) or CSV samplesheet file containing information about the samples in the experiment.

required
type: string
pattern: ^\S+\.csv$|^\S+\.(fastq|fq).gz$

Specifies that the input is single-end reads.

type: boolean

Additional input CSV samplesheet containing information about pre-computed assemblies. When set, both read pre-processing and assembly are skipped and the pipeline begins at the binning stage.

type: string

The output directory where the results will be saved. You have to use absolute paths to storage on Cloud infrastructure.

required
type: string

Email address for completion summary.

type: string
pattern: ^([a-zA-Z0-9_\-\.]+)@([a-zA-Z0-9_\-\.]+)\.([a-zA-Z]{2,5})$

MultiQC report title. Printed as page header, used for filename if not otherwise specified.

type: string

Reference genome related files and options required for the workflow.

Directory / URL base for iGenomes references.

hidden
type: string
default: s3://ngi-igenomes/igenomes

Do not load the iGenomes reference config.

hidden
type: boolean

Parameters used to describe centralised config profiles. These should not be edited.

Git commit id for Institutional configs.

hidden
type: string
default: master

Base directory for Institutional configs.

hidden
type: string
default: https://raw.githubusercontent.com/nf-core/configs/master

Institutional config name.

hidden
type: string

Institutional config description.

hidden
type: string

Institutional config contact information.

hidden
type: string

Institutional config URL link.

hidden
type: string

Set the top limit for requested resources for any single job.

Maximum number of CPUs that can be requested for any single job.

hidden
type: integer
default: 16

Maximum amount of memory that can be requested for any single job.

hidden
type: string
default: 128.GB
pattern: ^\d+(\.\d+)?\.?\s*(K|M|G|T)?B$

Maximum amount of time that can be requested for any single job.

hidden
type: string
default: 240.h
pattern: ^(\d+\.?\s*(s|m|h|d|day)\s*)+$

Less common options for the pipeline, typically set in a config file.

Display help text.

hidden
type: boolean

Display version and exit.

hidden
type: boolean

Method used to save pipeline results to output directory.

hidden
type: string

Email address for completion summary, only when pipeline fails.

hidden
type: string
pattern: ^([a-zA-Z0-9_\-\.]+)@([a-zA-Z0-9_\-\.]+)\.([a-zA-Z]{2,5})$

Send plain-text email instead of HTML.

hidden
type: boolean

File size limit when attaching MultiQC reports to summary emails.

hidden
type: string
default: 25.MB
pattern: ^\d+(\.\d+)?\.?\s*(K|M|G|T)?B$

Do not use coloured log outputs.

hidden
type: boolean

Incoming hook URL for messaging service

hidden
type: string

Custom config file to supply to MultiQC.

hidden
type: string

Custom logo file to supply to MultiQC. File name must also be set in the MultiQC config file

hidden
type: string

Custom MultiQC yaml file containing HTML including a methods description.

type: string

Boolean whether to validate parameters against the schema at runtime

hidden
type: boolean
default: true

Show all params when using --help

hidden
type: boolean

Validation of parameters fails when an unrecognised parameter is found.

hidden
type: boolean

Validation of parameters in lenient more.

hidden
type: boolean

Use these parameters to also enable reproducible results from the individual assembly and binning tools .

Fix number of CPUs for MEGAHIT to 1. Not increased with retries.

type: boolean

Fix number of CPUs used by SPAdes. Not increased with retries.

type: integer
default: -1

Fix number of CPUs used by SPAdes hybrid. Not increased with retries.

type: integer
default: -1

RNG seed for MetaBAT2.

type: integer
default: 1

Specify which adapter clipping tool to use.

type: string

Specify to save the resulting clipped FASTQ files to —outdir.

type: boolean

The minimum length of reads must have to be retained for downstream analysis.

type: integer
default: 15

Minimum phred quality value of a base to be qualified in fastp.

type: integer
default: 15

The mean quality requirement used for per read sliding window cutting by fastp.

type: integer
default: 15

Save reads that fail fastp filtering in a separate file. Not used downstream.

type: boolean

The minimum base quality for low-quality base trimming by AdapterRemoval.

type: integer
default: 2

Turn on quality trimming by consecutive stretch of low quality bases, rather than by window.

type: boolean

Forward read adapter to be trimmed by AdapterRemoval.

type: string
default: AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG

Reverse read adapter to be trimmed by AdapterRemoval for paired end data.

type: string
default: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT

Name of iGenomes reference for host contamination removal.

type: string

Fasta reference file for host contamination removal.

type: string

Use the --very-sensitive instead of the--sensitivesetting for Bowtie 2 to map reads against the host genome.

type: boolean

Save the read IDs of removed host reads.

type: boolean

Specify to save input FASTQ files with host reads removed to —outdir.

type: boolean

Keep reads similar to the Illumina internal standard PhiX genome.

type: boolean

Genome reference used to remove Illumina PhiX contaminant reads.

hidden
type: string
default: ${baseDir}/assets/data/GCA_002596845.1_ASM259684v1_genomic.fna.gz

Skip read preprocessing using fastp or adapterremoval.

type: boolean

Specify to save input FASTQ files with phiX reads removed to —outdir.

type: boolean

Run BBnorm to normalize sequence depth.

type: boolean

Set BBnorm target maximum depth to this number.

type: integer
default: 100

Set BBnorm minimum depth to this number.

type: integer
default: 5

Save normalized read files to output directory.

type: boolean

Skip removing adapter sequences from long reads.

type: boolean

Discard any read which is shorter than this value.

type: integer
default: 1000

Keep this percent of bases.

type: integer
default: 90

The higher the more important is read length when choosing the best reads.

type: integer
default: 10

Keep reads similar to the ONT internal standard Escherichia virus Lambda genome.

type: boolean

Genome reference used to remove ONT Lambda contaminant reads.

hidden
type: string
default: ${baseDir}/assets/data/GCA_000840245.1_ViralProj14204_genomic.fna.gz

Specify to save input FASTQ files with lamba reads removed to —outdir.

type: boolean

Specify to save the resulting clipped FASTQ files to —outdir.

type: boolean

Specify to save the resulting length filtered FASTQ files to —outdir.

type: boolean

Taxonomic classification is disabled by default. You have to specify one of the options below to activate it.

Database for taxonomic binning with centrifuge.

type: string

Database for taxonomic binning with kraken2.

type: string

Database for taxonomic binning with krona

type: string

Skip creating a krona plot for taxonomic binning.

type: boolean

Database for taxonomic classification of metagenome assembled genomes. Can be either a zipped file or a directory containing the extracted output of such.

type: string

Generate CAT database.

type: boolean

Save the CAT database generated when specified by --cat_db_generate.

type: boolean

Only return official taxonomic ranks (Kingdom, Phylum, etc.) when running CAT.

type: boolean

Skip the running of GTDB, as well as the automatic download of the database

type: boolean

Specify the location of a GTDBTK database. Can be either an uncompressed directory or a .tar.gz archive. If not specified will be downloaded for you when GTDBTK or binning QC is not skipped.

type: string
default: https://data.ace.uq.edu.au/public/gtdb/data/releases/release214/214.1/auxillary_files/gtdbtk_r214_data.tar.gz

Specify the location of a GTDBTK mash database. If missing, GTDB-Tk will skip the ani_screening step

type: string

Min. bin completeness (in %) required to apply GTDB-tk classification.

type: number
default: 50

Max. bin contamination (in %) allowed to apply GTDB-tk classification.

type: number
default: 10

Min. fraction of AA (in %) in the MSA for bins to be kept.

type: number
default: 10

Min. alignment fraction to consider closest genome.

type: number
default: 0.65

Number of CPUs used for the by GTDB-Tk run tool pplacer.

type: number
default: 1

Reduce GTDB-Tk memory consumption by running pplacer in a setting writing to disk.

type: boolean
default: true

Database for virus classification with geNomad

type: string

Co-assemble samples within one group, instead of assembling each sample separately.

type: boolean

Additional custom options for SPAdes.

type: string

Additional custom options for MEGAHIT.

type: string

Skip Illumina-only SPAdes assembly.

type: boolean

Skip SPAdes hybrid assembly.

type: boolean

Skip MEGAHIT assembly.

type: boolean

Skip metaQUAST.

type: boolean

Skip Prodigal gene prediction

type: boolean

Skip Prokka genome annotation.

type: boolean

Skip MetaEuk gene prediction and annotation

type: boolean

A string containing the name of one of the databases listed in the mmseqs2 documentation. This database will be downloaded and formatted for eukaryotic genome annotation. Incompatible with —metaeuk_db.

type: string

Path to either a local fasta file of protein sequences, or to a directory containing an mmseqs2-formatted database, for annotation of eukaryotic genomes.

type: string

Save the downloaded mmseqs2 database specified in --metaeuk_mmseqs_db.

type: boolean

Run virus identification.

type: boolean

Minimum geNomad score for a sequence to be considered viral

type: number
default: 0.7

Number of groups that geNomad’s MMSeqs2 databse should be split into (reduced memory requirements)

type: integer
default: 1

Defines mapping strategy to compute co-abundances for binning, i.e. which samples will be mapped against the assembly.

type: string
default: group

Skip metagenome binning entirely

type: boolean

Skip MetaBAT2 Binning

type: boolean

Skip MaxBin2 Binning

type: boolean

Skip CONCOCT Binning

type: boolean

Minimum contig size to be considered for binning and for bin quality check.

type: integer
default: 1500

Minimal length of contigs that are not part of any bin but treated as individual genome.

type: integer
default: 1000000

Maximal number of contigs that are not part of any bin but treated as individual genome.

type: integer
default: 100

Bowtie2 alignment mode

type: string

Save the output of mapping raw reads back to assembled contigs

type: boolean

Enable domain-level (prokaryote or eukaryote) classification of bins using Tiara. Processes which are domain-specific will then only receive bins matching the domain requirement.

type: boolean

Specify which tool to use for domain classification of bins. Currently only ‘tiara’ is implemented.

hidden
type: string
default: tiara

Minimum contig length for Tiara to use for domain classification. For accurate classification, should be longer than 3000 bp.

type: integer
default: 3000

Disable bin QC with BUSCO or CheckM.

type: boolean

Specify which tool for bin quality-control validation to use.

type: string

Download URL for BUSCO lineage dataset, or path to a tar.gz archive, or local directory containing already downloaded and unpacked lineage datasets.

type: string

Run BUSCO with automated lineage selection, but ignoring eukaryotes (saves runtime).

type: boolean

Save the used BUSCO lineage datasets provided via --busco_db.

type: boolean

Enable clean-up of temporary files created during BUSCO runs.

type: boolean

URL pointing to checkM database for auto download, if local path not supplied.

hidden
type: string
default: https://data.ace.uq.edu.au/public/CheckM_databases/checkm_data_2015_01_16.tar.gz

Path to local folder containing already downloaded and uncompressed CheckM database.

type: string

Save the used CheckM reference files downloaded when not using —checkm_db parameter.

type: boolean

Turn on bin refinement using DAS Tool.

type: boolean

Specify single-copy gene score threshold for bin refinement.

type: number
default: 0.5

Specify which binning output is sent for downstream annotation, taxonomic classification, bin quality control etc.

type: string

Turn on GUNC genome chimerism checks

type: boolean

Specify a path to a pre-downloaded GUNC dmnd database file

type: string

Specify which database to auto-download if not supplying own

type: string

Save the used GUNC reference files downloaded when not using —gunc_db parameter.

type: boolean

Performs ancient DNA assembly validation and contig consensus sequence recalling.

Turn on/off the ancient DNA subworfklow

type: boolean

PyDamage accuracy threshold

type: number
default: 0.5

deactivate damage correction of ancient contigs using variant and consensus calling

type: boolean

Ploidy for variant calling

type: integer
default: 1

minimum base quality required for variant calling

type: integer
default: 20

minimum minor allele frequency for considering variants

type: number
default: 0.33

minimum genotype quality for considering a variant high quality

type: integer
default: 30

minimum genotype quality for considering a variant medium quality

type: integer
default: 20

minimum number of bases supporting the alternative allele

type: integer
default: 3